Establishment of an in-house one-step real-time RT-PCR assay for detection of Zaire ebolavirus

Đăng ngày 11/29/2019 6:26:43 AM | Thể loại: | Lần tải: 0 | Lần xem: 2 | Page: 5 | FileSize: 0.86 M | File type: PDF
Establishment of an in-house one-step real-time RT-PCR assay for detection of Zaire ebolavirus. Ebola virus is a deadly causative agent with a high mortality rate of up to 90%, therefore it has been classified by the Center for Disease Control and Prevention (CDC) as a category A biological agent. The World Health Organization (WHO) recommended using RT-PCR based assays to rapidly detect the virus. In the present study, we established an in-house assay for detection of Zaire ebolavirus via real-time RT-PCR. The nucleotide sequence of the Zaire ebolavirus nucleoprotein (NP) gene was retrieved from the Genbank for designing primer pairs and probes using Primer Express 3.0 software. The RNA positive control was generated by in vitro RNA transcript synthesis. The optimal components in the 20 μl final volume of the real-time RT-PCR assay were 10 μl 2X QuantiTect Probe RT-PCR master mix, 0,6 μM of each primer, 0,1 μM of the probe, 0,2 μl RT mix and 5 μl of RNA template. The thermal cycle conditions were as follows: 50o C for 30 min, 95°C for 15 min, then 45 cycles of 15 s at 94°C, 60s at 60°C. The limit of detection of the assay was 100 copies/reaction and 1414 FFU/ml with the positive RNA panel and sample panel of RNA extracted from cell culture supernatants of cells infected with Zaire ebolavirus 2014/Gueckedou-C05, respectively. The specificity of this assay was 100% when tested with the positive RNA panel of Ebola virus and other haemorrhagic fever viruses. In conclusion, we successfully established an in-house real-time RT-PCR assay for detection of Zaire ebolavirus in Vietnam with a limit of detection of 1414 FFU/ml and specificity of 100%.
life sciences | mediCine, BioteChnology
Establishment of an in-house one-step real-time
RT-PCR assay for detection of Zaire ebolavirus
Xuan Su Hoang1*, Thi Thu Hang Dinh1*, Van Tong Hoang1, Huu Tho Ho1,
Tien Sy Bui2, Van An Nguyen1, Thai Son Nguyen1
1Vietnam Military Medical University, Ministry of Defense
2108 Military Central Hospital, Ministry of Defense
Received 5 June 2017; accepted 10 October 2017
Abstract:
family consisting of the five species:
Ebola virus is a deadly causative agent with a high mortality rate of up
to 90%, therefore it has been classified by the Center for Disease Control
and Prevention (CDC) as a category A biological agent. The World Health
Organization (WHO) recommended using RT-PCR based assays to rapidly
detect the virus. In the present study, we established an in-house assay for
detection of Zaire ebolavirus via real-time RT-PCR. The nucleotide sequence of
the Zaire ebolavirus nucleoprotein (NP) gene was retrieved from the Genbank
for designing primer pairs and probes using Primer Express 3.0 software. The
RNA positive control was generated by in vitro RNA transcript synthesis. The
optimal components in the 20 μl final volume of the real-time RT-PCR assay
were 10 μl 2X QuantiTect Probe RT-PCR master mix, 0,6 μM of each primer,
0,1 μM of the probe, 0,2 μl RT mix and 5 μl of RNA template. The thermal
Zaire ebolavirus (ZEBOV), Sudan
ebolavirus (SEBOV), Reston ebolavirus
(REBOV), Bundibugyo ebolavirus
(BEBOV) and Tai Forest ebolavirus
(TEBOV) [1] EBOV is an enveloped,
negative-sense, and single-strand RNA
virus with its genome (19 kb in length)
encoding for 7 proteins including
nucleoprotein (NP), viral protein(VP35),
matrix protein (VP40), glycoprotein
(GP), replication-transcription protein
(VP30), matrix protein (VP24), and
cycle conditions were as follows: 50oC for 30 min, 95°C for 15 min, then 45
RNA dependent RNA polymerase (L).
cycles of 15 s at 94°C, 60s at 60°C. The limit of detection of the assay was 100
No available vaccines or antiviral drugs
copies/reaction and 1414 FFU/ml with the positive RNA panel and sample
exist for prevention and treatment of
panel of RNA extracted from cell culture supernatants of cells infected with
the
EBOV
disease.
Therefore,
early
Zaire ebolavirus 2014/Gueckedou-C05, respectively. The specificity of this
detection of suspected cases is critical
assay was 100% when tested with the positive RNA panel of Ebola virus and
other haemorrhagic fever viruses. In conclusion, we successfully established an
in-house real-time RT-PCR assay for detection of Zaire ebolavirus in Vietnam
with a limit of detection of 1414 FFU/ml and specificity of 100%.
for the management, surveillance and
control of this deadly epidemic. Real-
time RT-PCR assays were used routinely
in the laboratory of clinical virology
Keywords: ebola virus, real-time RT-PCR, Vietnam, Zaire ebolavirus.
Classification number: 3.2, 3.5
due to high sensitivity, specificity
and rapid results, therefore the WHO
recommended the use of a real-time
RT-PCR assay as the first choice for
detection of EBOV in clinical virology
Introduction
Ebola virus (EBOV) is a fetal
causative agent of severe hemorrhagic
fever epidemic with a high mortality
rate of up to 90%. The virus was firstly
discovered in 1976 when it caused two
simultaneous outbreaks in Sudan and
Zaire (now Democracy Republic of
Congo) [1]. The recent Ebola outbreak in
with more than 28,602 suspected cases
and 11,301 deaths. The cause of this
outbreak was then identified as a Makona
variant of Zaireebola virus [2]. The
WHO declared the outbreak of EBOV
disease in West Africa as a “Public health
emergency of international concern” and
called for a substantial global response
in order to control this epidemic [3].
laboratories [4]. However, commercial
real-time RT-PCR kits approved by
the FDA were not available before the
arrival of the epidemic in late 2013.
Other relevant assays including ELISA,
require a Bio safety level 4 (BSL-4)
facility for isolation and viral culture
[5]. Therefore, a simple, sensitive,
and accurate assay based on real-time
PCR, which is affordable in countries
Western Africa was the largest in history
EBOV belongs
to
the
Filoviridae
of limited resources, is
essential for
*Corresponding author: Email: hoangxuansu@vmmu.edu.vn
December 2017 Vol.59 Number 4
Vietnam Journal of Science,
Technology and Engineering
51
life sciences | mediCine, BioteChnology
early detection of EBOV in inactivated
BSL-4
conditions
in
the
department
1,400.3 ng/µl (1.44 x 1012 copies/µl)
specimens
[6].
This
study
aims
to
of
virology
at
Bernhard
Notch
of
and 2.01 A260/A280 ratio. Moreover,
establish and evaluate a real-time RT-
Tropical Medicine (BNITM), Hamburg,
the RNA transcript was determined by
PCR assay for detection of ZEBOV.
Germany.
Extracted
RNA
samples
specific size 1806 base in gel agarose
Materials and methods
were prepared at a concentration of 106
copies/ml.
electrophoresis (Data not shown).
Additionally, the quality of RNA
Preparation of ZEBOV RNA
positive standard
The 1306 bp nucleotide sequence
of a partial NP gene and 3’ untranslated
region (3’UTR) of recently epidemic
ZEBOV strain (GenBank: KJ660348)
was chemically synthesized and
inserted into the pIDTBlue vector
(4 μg) by IDT (USA). This plasmid
was linearized by digestion with PciI
restriction enzyme for in vitro RNA
transcription with a Transcript Aid T7
High Yield Transcription Kit (Thermo
Scientific), and the synthetic viral
RNA transcripts were purified using
a GeneJET RNA Purification Kit
(Thermo Scientific) according to the
manufacturer’s instructions. The RNA
level was measured by a Nanodrop
ND1000 spectrophotometer (Thermo
Fisher Scientific) and then converted to
the number of copies per μl. The RNA
transcript was stored at -80oC for further
use.
RNA extraction
One-step real-time RT-PCR assay
A one-step real-time RT-PCR assay
was optimized by using QuantiTect
Probe RT-PCR Master mix (Qiagen)
in a final volume of 20 μl including 5
μl of RNA. Real-time RT-PCR assays
were performed using the Rotor-
Gene Q Instrument (Qiagen) as well
as LigthCycler 2.0, LighCycler 480 II
Instrument (Roche) with thermal cycle
parameters as follows: 50oC for 30 min,
95oC for 15 min, then 45 cycles of 15
s at 94oC and 60 s at 60oC. Fluorescent
signals were recorded during each
annealing step of the amplification
cycle and a threshold signal was chosen
at 0,1 to determine the threshold cycle
(Ct) value during the analysis process
for the Rotor-Gene Q Instrument and
automated mode for Roche Instrument.
All experiments were tested in duplicate
within or between runs.
A 10-fold serial dilution from
106 to 100 copies/μl of transcribed
RNA and RNA extracted from cell
transcript was evaluated by using our
previously developed one-step RT-PCR
assay for EBOV detection. The RT-PCR
product of the ZEBOV RNA in a 106
copies/μl concentration is a specific and
thick band 830 bp in length (RTmix (+)),
whereas there is no band for RT mix (-)
RT-PCR (Lane 2 and 3, Fig. 1). Positive
RT-PCR product was confirmed exactly
by direct sequencing (Data not shown).
Fig. 1. Evaluation of ZEBOV RNA
transcript by one-step RT-PCR
assay. m. marker 100 bp (Thermo
Scientific), 1. Negative control; 2. rT-
Pcr with enzyme rT mix, 3. rT- Pcr
without enzyme rT mix, 4. Positive
control plasmid.
Development and optimization of
one-step real-time RT-PCR
830 bp
RNA samples were extracted from
140 μl of clinical samples collected
from patients in recently Ebola stricken
Guinea and from cell culture supernatant
of cells infected with ZEBOV2014/
Gueckedou-C05 and other haemorrhagic
virus species including SEBOV, REBOV,
culture supernatant of infected cells
with ZEBOV 2014/Gueckedou-C05
(1.65x105-1.65x100 FFU) was used to
determine the limit of detection (LoD).
The LoD was defined as the lowest RNA
concentration detected in all runs of the
20 replicates.
Design primer and probe: A
nucleotide sequences of the NP gene
retrieved from the Genbank database
was used for alignment with Clustal
W to identify the conserved region for
designing a primer and probe. We used
Primer Express 3.0 software to design
TEBOV and the Marburg virus [Leiden-
BNI 2008], and plasma of patients
infected with dengue virus, Zika virus
and chikungunya virus for assay cross-
reactivity and specificity evaluation using
QIAamp Viral RNA Mini Kit (Qiagen
GmbH, Hilden, Germany) according
Statistical analysis
The regression and the coefficient
of variation (CV) of the mean Ct value
for each standard concentration within
and between individual PCR runs were
analyzed by using statistical excel.
primers in highly conserved regions of the
NPgene. The primer and probe sequences
were as follows: EBOV-forward:
5’-GACAAATTGCTCGGAATCAC-3’;
E B O V - r e v e r s e : 5 ’ -
ATCTTGTGGTAATCCATGTCAG-3’
and probe: 5’ FAM -
to the manufacturer’s instructions. All
clinical samples were inactivated before
doing extraction by using an AVL buffer
Results
ZEBOV RNA positive standard
CAGTGAGACTCGGCGTCATCCAGA
- TAMRA 3´ that amplified 103 bp in
length real-time PCR product (Fig.
and absolute ethanol; then samples were
The transcribed ZEBOV RNA was
2). The primer-probe sequences were
incubated at 60oC for 60 minutes under
yielded with a high concentration of
checked with a Blast primer tool.
52
Vietnam Journal of Science,
Technology and Engineering
December 2017 Vol.59 Number 4